cfDNA Reference Standard

Determine the efficiency of cfDNA extraction from plasma or urine samples using this easy-to-use cfDNA Reference Standard 

cfDNA Reference Standard product image 2

cfDNA Reference Standard

PN 409000

LIST PRICE: $490.00 (USD) - Click to Purchase

Summary Product Benefits:

  • Convenient - 5 individual thaw-and-use tubes
  • Control -  determine the efficiency of your extraction method
  • Standard - acknowledged standard for spike-and-recovery cfDNA extraction experiments

The nRichDX cfDNA Reference Standard contains 5 single-use tubes containing 1 mL at a 1 ng/µl concentration in TE Buffer. Comparing the spike-in amount to the recovery amount, the percent recovery is determined.

The cfDNA Reference Standard contains mononucleosomal DNA (mnDNA) containing the KRAS G12V and TP53 Arg158Leu variants, which are established standards for spike-and-recovery extraction analysis for cfDNA*.

The expected mnDNA size is 150 bp. mnDNA is obtained from the NCI-H441 lung cancer cell line. The material is deproteinized; fragment sizes are nuclesome-defined, but histones are removed during purification.

Dinucleosomes and trinucleosomes may also be observed at the given multiples of 340 bp and 560 bp.

Resources:

PCR Assay Information 

KRAS qPCR Sequences:

Type

Description

Quantity

Sequence

KRAS Probe

MGB Probe 

60 nmoles

/56-FAM/CTGTATCGTCAAGGCACT/3MGBEc/

KRAS G12V

Forward Primer

40-50nmoles

AAACTTGTGGTAGTTGGAGCAGT

KRAS G12V

Reverse Primer

40-50nmoles

CATATTCGTCCACAAAATGATTCTG

 

Preparation of KRAS Probe (5 µM):

Description

Quantity For

500µL 1mL 2mL 5mL

KRAS Probe (10 µM)

250µL 500µL 1000µL 2500µL

10mM Tris, 1mM EDTA, pH 8.0

250µL 500µL 1000µL 2500µL

 

Preparation of KRAS G12V Primer Pool (3.5 µM):

Description

Quantity For

500µL 1mL 2mL

KRAS G12V Primer (6.25 µM)

280µL 560µL 1120µL

10mM Tris, 1mM EDTA, pH 8.0

220µL 440µL 880µL

 

Cycling Conditions for the Assay:

cfDNA Reference Standard PCR Assay Cycling Conditions

Expected Results:

cfDNA Reference Standard_gel and table_2
cfDNA Reference Standard_Tracing

 

*Lampignano R, et al. Multicenter Evaluation of Circulating Cell-Free DNA Extraction and Downstream Analyses for the Development of Standardized (Pre)analytical Work Flows. Clin Chem. 2020 Jan 1;66(1):149-160. doi: 10.1373/clinchem.2019.306837. PMID: 31628139

For Research Use Only. Not for use in diagnostic procedures.

Ready to learn more?

Request demo

Keep up to date with nRichDX

You’ll be the first to know about product updates and latest industry news.