cfDNA Reference Standard
Determine the efficiency of cfDNA extraction from plasma or urine samples using this easy-to-use cfDNA Reference Standard

cfDNA Reference Standard
PN 100479
Summary Product Benefits:
- Convenient - 5 individual thaw-and-use tubes
- Control - determine the efficiency of your extraction method
- Standard - acknowledged standard for spike-and-recovery cfDNA extraction experiments
The nRichDX cfDNA Reference Standard contains 5 single-use tubes containing 1 mL at a 1 ng/µl concentration in TE Buffer. Comparing the spike-in amount to the recovery amount, the percent recovery is determined.
The cfDNA Reference Standard contains mononuclear DNA (mnDNA) containing the KRAS G12V and TP53 Arg158Leu variants, which are established standards for spike-and-recovery extraction analysis for cfDNA*.
The expected mnDNA size is 150 bp. mnDNA is obtained from the NCI-H441 lung cancer cell line. Dinucleosomes and trinucleosomes may also be observed at the given multiples of 340 bp and 560 bp.
Resources:
PCR Assay Information
KRAS qPCR Sequences:
Type |
Description |
Quantity |
Sequence |
KRAS Probe |
MGB Probe |
60 nmoles |
/56-FAM/CTGTATCGTCAAGGCACT/3MGBEc/ |
KRAS G12V |
Forward Primer |
40-50nmoles |
AAACTTGTGGTAGTTGGAGCAGT |
KRAS G12V |
Reverse Primer |
40-50nmoles |
CATATTCGTCCACAAAATGATTCTG |
Preparation of KRAS Probe (5 µM):
Description |
Quantity For |
|||
500µL | 1mL | 2mL | 5mL | |
KRAS Probe (10 µM) |
250µL | 500µL | 1000µL | 2500µL |
10mM Tris, 1mM EDTA, pH 8.0 |
250µL | 500µL | 1000µL | 2500µL |
Preparation of KRAS G12V Primer Pool (3.5 µM):
Description |
Quantity For |
||
500µL | 1mL | 2mL | |
KRAS G12V Primer (6.25 µM) |
280µL | 560µL | 1120µL |
10mM Tris, 1mM EDTA, pH 8.0 |
220µL | 440µL | 880µL |
Cycling Conditions for the Assay:

Expected Results:


*Lampignano R, et al. Multicenter Evaluation of Circulating Cell-Free DNA Extraction and Downstream Analyses for the Development of Standardized (Pre)analytical Work Flows. Clin Chem. 2020 Jan 1;66(1):149-160. doi: 10.1373/clinchem.2019.306837. PMID: 31628139
For Research Use Only. Not for use in diagnostic procedures.
Ready to learn more?
Keep up to date with nRichDX
You’ll be the first to know about product updates and latest industry news.